Top » Catalog » R1b » A10109

$18.00

A10109
[A10109]

A10109
HG19 Position: ChrY:15007318..15007318
Ancestral: A
Derived: G
Reference: Douglas Fisher (2016)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: A10109_F GGGAGTTACTGCGGGAAAAC
Reverse Primer: A10109_R ACCCAAGGGAGGTGAGTTTC
Reviews

Customers who bought this product also purchased
A10106
A10106
S7019
S7019
A10107
A10107
A10108
A10108
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies