Top » Catalog » R1b » A10113

$18.00

A10113
[A10113]

A10113
HG19 Position: ChrY:8001905..8001905
Ancestral: A
Derived: G
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10113_F TCCTTATAGGGGAACATTTCCAG
Reverse Primer: A10113_R TGCAGTCCAGAATCTCAGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies