Top » Catalog » R1b » A10114

$18.00

A10114
[A10114]

A10114
HG19 Position: ChrY:11059943..11059943
Ancestral: A
Derived: C
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10114_F GCCTTCTCTGCTGAGTCAATG
Reverse Primer: A10114_R ATGGCTTCTCCTCTGGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies