Top » Catalog » R1b » A10119

$18.00

A10119
[A10119]

A10119
hg38 Position: ChrY:21354682..21354682
Ancestral: A
Derived: G
Reference: Aaron Pierce (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS9686
Forward Primer: A10119_F GCTCCCAGAATGAATGAAGC
Reverse Primer: A10119_R CAAGCTTCCTGGCTGTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies