Top » Catalog » R1b » A10124

$17.50

A10124
[A10124]

A10124
HG19 Position: ChrY:7701235..7701235
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10124_F CCCTTGAATAAGACCTTGTGTAGG
Reverse Primer: A10124_R CAGAATTAACATGACCAGGAAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies