Top » Catalog » R1b » A10125

$16.00

A10125
[A10125]

A10125
HG19 Position: ChrY:8012099..8012099
Ancestral: A
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10125_F GACACGCATTAGTGCTACCAATAG
Reverse Primer: A10125_R TAGCTCACTGCAACCTCTGTCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies