Top » Catalog » R1b » A10129

$18.00

A10129
[A10129]

A10129
hg38 Position: ChrY:12665375..12665375
Ancestral: T
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10129v2_F TGACTACATAATGGCAAAAACATTG
Reverse Primer: A10129v2_R CACCATGCCCAGCTAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies