Top » Catalog » R1b » A10130

$18.00

A10130
[A10130]

A10130
hg38 Position: ChrY:13024174..13024174
Ancestral: T
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10130_F TCAAAGGTTCCTGGTTCTGG
Reverse Primer: A10130_R CCAGCTGTAGGGGATCTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies