Top » Catalog » R1b » A10131

$18.00

A10131
[A10131]

A10131
HG19 Position: ChrY:15154446..15154446
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10131_F GGGGAGACTCAGCACTCTTG
Reverse Primer: A10131_R CATGGCACATTCACACTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies