Top » Catalog » R1b » A10132

$17.50

A10132
[A10132]

A10132
HG19 Position: ChrY:15929003..15929003
Ancestral: T
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10132_F CTCCAGAGGCCTAAGGATTTC
Reverse Primer: A10132_R CTTGCTTGACTGACGGAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies