Top » Catalog » R1b » A10134

$18.00

A10134
[A10134]

A10134
HG19 Position: ChrY:16218512..16218512
Ancestral: T
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10134_F CCAGGCAGAATTTGTACTGGATAG
Reverse Primer: A10134_R CCAGCTTCAGTAACAGAACAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies