Top » Catalog » R1b » A10135

$17.50

A10135
[A10135]

A10135
HG19 Position: ChrY:16218979..16218979
Ancestral: G
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10135_F TGCTCAATCATAAGCAGCTACC
Reverse Primer: A10135_R GCACCTCCACTACCAGACAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies