Top » Catalog » R1b » A10136

$18.00

A10136
[A10136]

A10136
HG19 Position: ChrY:16219139..16219139
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10136_F CATGGTCTTGCTGTGTTTCC
Reverse Primer: A10136_R GAAAAGGGCGGTGTGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies