Top » Catalog » R1b » A10138

$17.50

A10138
[A10138]

A10138
HG19 Position: ChrY:16711137..16711137
Ancestral: T
Derived: G
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10138_F AGTGATGGAGACATTGATGGTTC
Reverse Primer: A10138_R AAGTCTACATCTGTCCTGTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies