Top » Catalog » R1b » A10139

$17.50

A10139
[A10139]

A10139
HG19 Position: ChrY:16761721..16761721
Ancestral: G
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10139_F CAATGTGGATGGTAGATCAGTGG
Reverse Primer: A10139_R ATGGGATAGTCTGAGGCACAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies