Top » Catalog » R1b » A10141

$18.00

A10141
[A10141]

A10141
hg38 Position: ChrY:15592546..15592546
Ancestral: C
Derived: A
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10141_F CCACAGACTTCTGCAGATTGTG
Reverse Primer: A10141_R AGGGGAGCTTTCAAGATTGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies