Top » Catalog » R1b » A10144

$17.50

A10144
[A10144]

A10144
HG19 Position: ChrY:18582996..18582996
Ancestral: A
Derived: C
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10144_F CCTTTCCAAAGGAGGCAATC
Reverse Primer: A10144_R CATGAAAATCATGTGTTCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies