Top » Catalog » R1b » A10154

$18.00

A10154
[A10154]

A10154
HG19 Position: ChrY:23462063..23462063
Ancestral: G
Derived: T
Reference: Connie McKenzie (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10154_F CTGCTTCTGAGATTGCGTTG
Reverse Primer: A10154_R AGTCAAAAATGGGGATGTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies