Top » Catalog » R1b » A10165

$18.00

A10165
[A10165]

A10165
HG19 Position: ChrY:21281530..21281530
Ancestral: C
Derived: T
Reference: John Plant (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. with FGC22149
Forward Primer: A10165_F CCCTGTTTCCCGAGGTATG
Reverse Primer: A10165_R CAAACTACAAGATGGCAATGAGT
Reviews

Customers who bought this product also purchased
PF374
PF374
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies