Top » Catalog » R1b » A10219

$18.00

A10219
[A10219]

A10219
HG19 Position: ChrY:18709505..18709505
Ancestral: T
Derived: G
Reference: David R Moore (2015)
ISOGG Haplogroup: R1b
Comments: Downstream of L1402
Forward Primer: A10219_F CGAACCCATCAAATAGTATCCTTC
Reverse Primer: A10219_R CTTGAAGCCTGGAGTTGGAG
Reviews

Customers who bought this product also purchased
A10218
A10218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies