Top » Catalog » R1b » A10233

$18.00

A10233
[A10233]

A10233
hg38 Position: ChrY:15059803..15059803
Ancestral: A
Derived: C
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10233_F ATTTAGATGCTTGCTGGAGTCAG
Reverse Primer: A10233_R CAAAGGGTTAGGGAAGACAGG
Reviews

Customers who bought this product also purchased
FGC12326
FGC12326
BZ2
BZ2
FGC12346
FGC12346
Z9
Z9
Z8172
Z8172
L47
L47
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies