Top » Catalog » R1b » A10234

$18.00

A10234
[A10234]

A10234
HG19 Position: ChrY:17439176..17439176
Ancestral: G
Derived: A
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10234_F CTGCTATATAAATTAACTCCATTCGG
Reverse Primer: A10234_R CTTGTCTCCCTTGGGGTTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies