Top » Catalog » R1b » A10236

$18.00

A10236
[A10236]

A10236
HG19 Position: ChrY:7689499..7689499
Ancestral: T
Derived: C
Reference: Preston N Garrison (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of FGC12346
Forward Primer: A10236_F CTCCGCCATTATGTCATCC
Reverse Primer: A10236_R GCCTGCCTAATGAAGTGAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies