Top » Catalog » R1b » A10241

$18.00

A10241
[A10241]

A10241
HG19 Position: ChrY:8336988..8336988
Ancestral: A
Derived: T
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10241_F TAATCAAAGGCCAGGCACAC
Reverse Primer: A10241_R AGACGCCAGGCAAAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies