Top » Catalog » R1b » A10242

$17.50

A10242
[A10242]

A10242
HG19 Position: ChrY:14536836..14536836
Ancestral: A
Derived: G
Reference: JB Royal (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of DF27
Forward Primer: A10242_F CAATAGACAGAATCTTTCTCAACTTTACTAC
Reverse Primer: A10242_R GTTTAAACATCCCTGCAACTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies