Top » Catalog » R1b » A10243

$18.00

A10243
[A10243]

A10243
HG19 Position: ChrY:19050325..19050325
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10243_F CAGGGAAAACAGGCAGACTC
Reverse Primer: A10243_R GGTGGAAGGATCATTTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies