Top » Catalog » R1b » A10244

$18.00

A10244
[A10244]

A10244
hg38 Position: ChrY:12367000..12367000
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10244_F GGGTCTTGAACAGCATACGTG
Reverse Primer: A10244_R TCTCTAGAGGAGGACTTCTCAACTATG
Reviews

Customers who bought this product also purchased
FGC15278
FGC15278
FGC15274
FGC15274
PF1237
PF1237
A5392
A5392
A10245
A10245
FGC15270
FGC15270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies