Top » Catalog » R1b » A10245

$18.00

A10245
[A10245]

A10245
hg38 Position: ChrY:16609758..16609758
Ancestral: C
Derived: A
Reference: Bruce Cockburn (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10245_F TGGAAATCTATCTGCAGGAATG
Reverse Primer: A10245_R TCCTGGGCAGTTGTTACAGG
Reviews

Customers who bought this product also purchased
PF1237
PF1237
FGC15278
FGC15278
FGC15274
FGC15274
A5395
A5395
A5392
A5392
A10244
A10244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies