Top » Catalog » R1b » A10285

$18.00

A10285
[A10285]

A10285
HG19 Position: ChrY:17049634..17049635
Ancestral: ins
Derived: del
Reference: William Davison (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1066
Forward Primer: A10285_F CAGTATAATGCTCTGGAGAGTAGCAG
Reverse Primer: A10285_R GGTCTTTTATCATAACCAACTCCG
Reviews

Customers who bought this product also purchased
A10287
A10287
A10286
A10286
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies