Top » Catalog » R1b » A10296

$18.00

A10296
[A10296]

A10296
hg38 Position: ChrY:8414092..8414092
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10296_F GATGCAAGAGAATCACTTTAACCTG
Reverse Primer: A10296_R TAACCTGTGGTCTCGGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies