Top » Catalog » R1b » A10298

$17.50

A10298
[A10298]

A10298
HG19 Position: ChrY:22663619..22663619
Ancestral: G
Derived: C
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10298_F TCAGGGCTGGATTCAAAAAC
Reverse Primer: A10298_R CAATGGGGCAAAACAACTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies