Top » Catalog » R1b » A10305

$18.00

A10305
[A10305]

A10305
HG19 Position: ChrY:22477104..22477104
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10305_F TAAAGGTGTTATTTCCATTGTTTGC
Reverse Primer: A10305_R GAAGGAACAAACTCTGGACATGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies