Top » Catalog » R1b » A10308

$17.50

A10308
[A10308]

A10308
HG19 Position: ChrY:16326305..16326305
Ancestral: C
Derived: G
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10308_F TCCCAAACTAGCCCAGAATG
Reverse Primer: A10308_R GGAGGGGCTATGGAGACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies