Top » Catalog » R1b » A10309

$18.00

A10309
[A10309]

A10309
hg38 Position: ChrY:15029338..15029338
Ancestral: G
Derived: A
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of CTS10893
Forward Primer: A10309_F TATTTTCATGTTTTGGAGACACC
Reverse Primer: A10309_R TGGAAAGTGTTTGGCTTAATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies