Top » Catalog » R1b » A10312

$18.00

A10312
[A10312]

A10312
HG19 Position: ChrY:6974345..6974345
Ancestral: G
Derived: T
Reference: Geoffrey Blackburn (2016)
ISOGG Haplogroup: R1b
Comments: Downstream of U106
Forward Primer: A10312_F GCTAACAAGCAATGGCACAG
Reverse Primer: A10312_R TCCAGGTAAGTGGCCAAAG
Reviews

Customers who bought this product also purchased
Y17730
Y17730
A10314
A10314
A10313
A10313
A10315
A10315
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies