Top » Catalog » R1b » A10317

$18.00

A10317
[A10317]

A10317
hg38 Position: ChrY:7405916..7405916
Ancestral: G
Derived: T
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10317_F AGAGTAAGCCCTATCAACAGCTAAG
Reverse Primer: A10317_R GCTGCTTATTGGTGCATGG
Reviews

Customers who bought this product also purchased
A10319
A10319
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies