Top » Catalog » R1b » A10318

$18.00

A10318
[A10318]

A10318
HG19 Position: ChrY:7562063..7562063
Ancestral: G
Derived: A
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10318_F GCTTAAAATAGACCACACCTGATTG
Reverse Primer: A10318_R AGGTGTGGTTCCAAGAAAGTG
Reviews

Customers who bought this product also purchased
A5625
A5625
A8449
A8449
S23035
S23035
A10639
A10639
A15515
A15515
R1b-Z255 Panel
R1b-Z255 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies