Top » Catalog » R1b » A10318

$18.00

A10318
[A10318]

A10318
hg38 Position: ChrY:7562063..7562063
Ancestral: G
Derived: A
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10318_F GCTTAAAATAGACCACACCTGATTG
Reverse Primer: A10318_R AGGTGTGGTTCCAAGAAAGTG
Reviews

Customers who bought this product also purchased
A15515
A15515
A5625
A5625
A8449
A8449
S23035
S23035
A10639
A10639
A1236
A1236
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies