Top » Catalog » R1b » A10318

$18.00

A10318
[A10318]

A10318
HG19 Position: ChrY:7430104..7430104
Ancestral: G
Derived: A
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10318_F GCTTAAAATAGACCACACCTGATTG
Reverse Primer: A10318_R AGGTGTGGTTCCAAGAAAGTG
Reviews

Customers who bought this product also purchased
S23035
S23035
A10639
A10639
A15515
A15515
A5625
A5625
A8449
A8449
A8429
A8429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies