Top » Catalog » R1b » A10319

$18.00

A10319
[A10319]

A10319
HG19 Position: ChrY:7820850..7820850
Ancestral: C
Derived: T
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10319_F GGTTACTAGGCATAGTGGTGTGAC
Reverse Primer: A10319_R GATGCACACATTACATTGTAAATTCC
Reviews

Customers who bought this product also purchased
A10317
A10317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies