Top » Catalog » R1b » A10320

$16.00

A10320
[A10320]

A10320
HG19 Position: ChrY:7906195..7906195
Ancestral: G
Derived: T
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10320_F AAGTGACGGCCTCCTTGAG
Reverse Primer: A10320_R TGCTAGCTTCAGCAATGTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies