Top » Catalog » R1b » A10325

$18.00

A10325
[A10325]

A10325
HG19 Position: ChrY:7271642..7271642
Ancestral: T
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10325_F CCCCATTCTCCCTTTCTCAC
Reverse Primer: A10325_R TGATTGCTGCCATCAATTCTATC
Reviews

Customers who bought this product also purchased
A13324
A13324
A10330
A10330
A10329
A10329
A10328
A10328
A10327
A10327
A10326
A10326
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies