Top » Catalog » R1b » A10329

$16.00

A10329
[A10329]

A10329
HG19 Position: ChrY:8070556..8070556
Ancestral: T
Derived: C
Reference: Craig Gaston (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z255
Forward Primer: A10329_F GATTACAGGCGTGAGCCAC
Reverse Primer: A10329_R CTCACAGGAAATCAGTCAGGAG
Reviews

Customers who bought this product also purchased
A10326
A10326
A10325
A10325
A13324
A13324
A10327
A10327
A10330
A10330
A10328
A10328
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies