Top » Catalog » R1b » A557

$18.00

A557
[A557]

A557
hg38 Position: ChrY:13975120..13975120
Ancestral: T
Derived: C
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1e~
Comments: Z255+ L159-
Forward Primer: A557_F CATATGGGGAAACGGAACAG
Reverse Primer: A557_R CATGGATTCCCTCCACATTC
Reviews

Customers who bought this product also purchased
FGC33232
FGC33232
FGC33228
FGC33228
A5629
A5629
Z29008
Z29008
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies