Top » Catalog » R1b » A557

$18.00

A557
[A557]

A557
hg38 Position: ChrY:13975120..13975120
Ancestral: T
Derived: C
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1e~
Comments: Z255+ L159-
Forward Primer: A557_F CATATGGGGAAACGGAACAG
Reverse Primer: A557_R CATGGATTCCCTCCACATTC
Reviews

Customers who bought this product also purchased
Z29008
Z29008
Z255
Z255
DF49
DF49
L1335
L1335
A5631
A5631
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies