Top » Catalog » R1b » A557

$18.00

A557
[A557]

A557
hg38 Position: ChrY:13975120..13975120
Ancestral: T
Derived: C
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1e~
Comments: Z255+ L159-
Forward Primer: A557_F CATATGGGGAAACGGAACAG
Reverse Primer: A557_R CATGGATTCCCTCCACATTC
Reviews

Customers who bought this product also purchased
Z29008
Z29008
FGC11134
FGC11134
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
L513
L513
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x A1321
1 x A1544
1 x A2143
1 x A765
1 x A1164
1 x A682
1 x A636
1 x A326
1 x A190
1 x A227
1 x A443
1 x A660
1 x A300
1 x A1223
1 x A20
1 x A412
1 x A2181
1 x A971
1 x A154
1 x A953
1 x A218
1 x A768
1 x A130
1 x A236
1 x A336
1 x A2182
$486.00
Haplogroup Info
Other products
Currencies