Top » Catalog » R1b » A1248

$18.00

A1248
[A1248]

A1248
hg38 Position: ChrY:15424586..15424586
Ancestral: G
Derived: A
Reference: YSEQ (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255 > Z16433
Forward Primer: A1248_F GCAAGAGAGAAAATGGGAGAGC
Reverse Primer: A1248_R CTTTCACTTTTGGCTCTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A589
1 x A350
$36.00
Haplogroup Info
Other products
Currencies