Top » Catalog » R1b » A578

$18.00

A578
[A578]

A578
hg38 Position: ChrY:19202353..19202353
Ancestral: G
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Below DF88
Forward Primer: A578_F TGGCTGGAAAGTGGGAATAG
Reverse Primer: A578_R ATACCTTCACCTGTTGCAGGA
Reviews (1)

Customers who bought this product also purchased
A1226
A1226
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A599
1 x A212
1 x A586
1 x A232
1 x A295
1 x A193
1 x A308
1 x A1280
1 x A2196
1 x A22
1 x A156
1 x A1506
1 x A319
1 x A155
1 x A885
1 x A470
1 x A323
1 x A158
1 x A430
1 x A798
1 x A1026
1 x A1543
1 x A1708
$414.00
Haplogroup Info
Other products
Currencies