Top » Catalog » R1b » A579

$18.00

A579
[A579]

A579
hg38 Position: ChrY:7869272..7869272
Ancestral: C
Derived: A
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Below DF88
Forward Primer: A579_F ATGATCTTGGTACAAATATGCAATG
Reverse Primer: A579_R GCACACAGCTACCTTAATATGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A494
$18.00
Haplogroup Info
Other products
Currencies