Top » Catalog » R1b » A580

$18.00

A580
[A580]

A580
hg38 Position: ChrY:16997438..16997438
Ancestral: T
Derived: G
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Below DF88
Forward Primer: A580_F GAAACCCTTGAGGAAGGCA
Reverse Primer: A580_R CAGCCTGACTAACAGTCAGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A585
1 x A432
1 x A1542
$54.00
Haplogroup Info
Other products
Currencies