Top » Catalog » R1b » A582

$18.00

A582
[A582]

A582
hg38 Position: ChrY:19542909..19542909
Ancestral: C
Derived: T
Reference: FTDNA (2014)
ISOGG Haplogroup: R1b1a2a1a2e1 (not listed)
Comments: Below DF88
Forward Primer: A582_F TGGCGCTTTCTCTGTATGC
Reverse Primer: A582_R TTGGGAACTTCCTCTTCTTCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies